| Label | Region | Length (bp) | Pi | Alignment reliability | MarkerSeek score | Primer available | Action |
|---|---|---|---|---|---|---|---|
| trnK-UUU-rps16 | LSC | 564 | 0.0486 | 0.98 | 76.2 | yes | View details |
| rps16-trnQ_UUG | LSC | 1454 | 0.0429 | 0.79 | 74.4 | yes | View details |
| trnS_GCU-trnG_UCC | LSC | 1178 | 0.0464 | 0.94 | 75.7 | yes | View details |
| trnC_GCA-petN | LSC | 990 | 0.0400 | 0.96 | 76.4 | yes | View details |
| trnT_GGU-psbD | LSC | 1058 | 0.0426 | 1.00 | 76.0 | yes | View details |
| trnT_UGU-trnL_UAA | LSC | 1023 | 0.0405 | 0.97 | 77.2 | yes | View details |
| petA-psbJ | LSC | 1157 | 0.0445 | 0.98 | 77.3 | yes | View details |
| ycf1 | IRb | 1237 | 0.0147 | 0.98 | 57.8 | no | View details |
| ndhF | SSC | 2217 | 0.0256 | 0.99 | 67.7 | yes | View details |
| ndhF-rpl32 | SSC | 382 | 0.0560 | 0.97 | 77.2 | yes | View details |
| rpl32-trnL_UAG | SSC | 700 | 0.0727 | 0.99 | 81.4 | yes | View details |
| rps15-ycf1 | SSC | 362 | 0.0572 | 0.91 | 69.0 | yes | View details |
| ycf1 | SSC | 5223 | 0.0330 | 0.99 | 67.8 | yes | View details |
| psbM-trnD_GUC | LSC | 1079 | 0.0341 | 0.99 | 79.8 | yes | View details |
| psbE-petL | LSC | 987 | 0.0295 | 0.98 | 76.4 | yes | View details |
| ndhC-trnV_UAC | LSC | 445 | 0.0408 | 0.98 | 75.3 | yes | View details |
| rpoB-trnC_GCA | LSC | 1251 | 0.0358 | 0.96 | 74.6 | yes | View details |
| petN-psbM | LSC | 848 | 0.0358 | 0.99 | 73.5 | yes | View details |
| trnG_UCC-trnR_UCU | LSC | 131 | 0.0541 | 0.99 | 72.6 | yes | View details |
| atpH-atpI | LSC | 490 | 0.0246 | 0.98 | 72.6 | yes | View details |
| ccsA-ndhD | SSC | 218 | 0.0595 | 0.99 | 71.5 | yes | View details |
| rps16 | LSC | 1089 | 0.0352 | 1.00 | 71.3 | yes | View details |
| Candidate markers include all hotspot labels marked in the diversity plot, listed in genomic order, plus the top 10 remaining regions by MarkerSeek score. Primer design is attempted for every listed region. Primer available: yes means at least one valid primer pair was found; no means no valid pair passed screening; NA means primer design was skipped. | |||||||
Species
227
Genome length
150–155 kb
Candidate markers
271
Primer pairs
105
Genome-wide nucleotide diversity
Candidate markers
13 hotspot labels from the diversity plot in genomic order, plus the top 9 remaining regions by MarkerSeek score (out of 271 candidates).
Primer pairs
Showing the top 30 of 105 primer pairs (ranked by primer score).
| Primer ID | Label | Forward | Reverse | Amplicon (bp) | Cross-species rate | Score |
|---|---|---|---|---|---|---|
| trnK-UUU-rps16_p1 | trnK-UUU-rps16 | CCTTTCAGGATCAGTCGTGG |
ATTGATGTTCGATCCCGACG |
752–923 | 0.938 | 88.2 |
| trnK-UUU-rps16_p2 | trnK-UUU-rps16 | TCAGGATCAGTCGTGGTCTT |
ATTGATGTTCGATCCCGACG |
748–919 | 0.938 | 87.8 |
| trnK-UUU-rps16_p3 | trnK-UUU-rps16 | TTCAGGATCAGTCGTGGTCT |
ATTGATGTTCGATCCCGACG |
749–920 | 0.938 | 87.8 |
| trnK-UUU-rps16_p4 | trnK-UUU-rps16 | ATCGCACTTAAAAGCCGAGT |
ATTGATGTTCGATCCCGACG |
667–838 | 0.938 | 87.6 |
| trnK-UUU-rps16_p5 | trnK-UUU-rps16 | CCTTTCAGGATCAGTCGTGG |
GGTGCTCAACCTACAGGAAC |
665–809 | 0.841 | 84.0 |
| rps16_p1 | rps16 | CCTTTCAGGATCAGTCGTGG |
CCATAGGATAGAGGGGCGAA |
1351–2048 | 0.863 | 85.9 |
| rps16_p2 | rps16 | TCAGGATCAGTCGTGGTCTT |
CCATAGGATAGAGGGGCGAA |
1347–2044 | 0.863 | 85.4 |
| rps16_p3 | rps16 | TTCAGGATCAGTCGTGGTCT |
CCATAGGATAGAGGGGCGAA |
1348–2045 | 0.863 | 85.4 |
| rps16_p4 | rps16 | CCTTTCAGGATCAGTCGTGG |
AGCAACAGCAGCTCTTTGAT |
2151–2540 | 0.445 | 68.9 |
| rps16_p5 | rps16 | CCTTTCAGGATCAGTCGTGG |
ATTTCAGCAACAGCAGCTCT |
2156–2545 | 0.401 | 67.2 |
| rps16-trnQ_UUG_p1 | rps16-trnQ_UUG | TATGTCCTTCAAGTCGCACG |
GAGGTTCGAATCCTTCCGTC |
351–1600 | 0.921 | 88.1 |
| rps16-trnQ_UUG_p2 | rps16-trnQ_UUG | AAGTCGCACGTTGCTTTCTA |
GAGGTTCGAATCCTTCCGTC |
341–1590 | 0.943 | 88.0 |
| rps16-trnQ_UUG_p3 | rps16-trnQ_UUG | TGGCGGATGTAAGAATCCAC |
GAGGTTCGAATCCTTCCGTC |
577–1627 | 0.894 | 84.6 |
| rps16-trnQ_UUG_p4 | rps16-trnQ_UUG | GGCGGATGTAAGAATCCACA |
GAGGTTCGAATCCTTCCGTC |
576–1626 | 0.890 | 84.4 |
| rps16-trnQ_UUG_p5 | rps16-trnQ_UUG | TATGTCCTTCAAGTCGCACG |
TTCGGAGGTTCGAATCCTTC |
355–1604 | 0.921 | 83.4 |
| trnS_GCU-trnG_UCC_p1 | trnS_GCU-trnG_UCC | GCTTTAGTCCACTCAGCCAT |
TGAACGAATCACACTTTTACCAC |
754–1351 | 1.000 | 61.4 |
| trnS_GCU-trnG_UCC_p2 | trnS_GCU-trnG_UCC | GCTTTAGTCCACTCAGCCAT |
ACGAATCACACTTTTACCACT |
751–1348 | 1.000 | 60.4 |
| trnS_GCU-trnG_UCC_p3 | trnS_GCU-trnG_UCC | AGTCCACTCAGCCATCTCTC |
TGAACGAATCACACTTTTACCAC |
749–1346 | 0.996 | 60.4 |
| trnS_GCU-trnG_UCC_p4 | trnS_GCU-trnG_UCC | GCTTTAGTCCACTCAGCCAT |
GAACGAATCACACTTTTACCACT |
753–1350 | 1.000 | 59.4 |
| trnS_GCU-trnG_UCC_p5 | trnS_GCU-trnG_UCC | AGTCCACTCAGCCATCTCTC |
ACGAATCACACTTTTACCACT |
746–1343 | 0.996 | 59.4 |
| trnG_UCC-trnR_UCU_p1 | trnG_UCC-trnR_UCU | AGCCTTCCAAGCTAACGATG |
AGAAGACCTCTGTCCTATCCA |
183–246 | 1.000 | 75.3 |
| trnG_UCC-trnR_UCU_p2 | trnG_UCC-trnR_UCU | CCTAGCCTTCCAAGCTAACG |
AGAAGACCTCTGTCCTATCCA |
186–249 | 1.000 | 75.1 |
| trnG_UCC-trnR_UCU_p3 | trnG_UCC-trnR_UCU | AGCCTTCCAAGCTAACGATG |
AGGTTTAGAAGACCTCTGTCCT |
189–252 | 1.000 | 74.7 |
| trnG_UCC-trnR_UCU_p4 | trnG_UCC-trnR_UCU | CCTAGCCTTCCAAGCTAACG |
AGGTTTAGAAGACCTCTGTCCT |
192–255 | 1.000 | 74.5 |
| trnG_UCC-trnR_UCU_p5 | trnG_UCC-trnR_UCU | CCCTAGCCTTCCAAGCTAAC |
AGAAGACCTCTGTCCTATCCA |
187–250 | 1.000 | 72.9 |
| atpH-atpI_p1 | atpH-atpI | ATAACGGAAGCGGCAGAAAT |
ATAGGGGAATCCATGGAGGG |
351–603 | 0.982 | 90.5 |
| atpH-atpI_p2 | atpH-atpI | CGCAATACCTTCTACGGCTT |
ATAGGGGAATCCATGGAGGG |
439–691 | 0.974 | 89.9 |
| atpH-atpI_p3 | atpH-atpI | AATAACGGAAGCGGCAGAAA |
ATAGGGGAATCCATGGAGGG |
352–604 | 0.982 | 89.3 |
| atpH-atpI_p4 | atpH-atpI | TACCTTGACCAACTCCAGGT |
ATAGGGGAATCCATGGAGGG |
407–659 | 0.969 | 89.3 |
| atpH-atpI_p5 | atpH-atpI | GCAGTACCTTGACCAACTCC |
ATAGGGGAATCCATGGAGGG |
411–663 | 0.978 | 89.1 |
Result downloads
Reference species (227)
One GenBank record per species. Use the NCBI button to open the Nucleotide entry for the listed accession.
| Species | Accession | Length (bp) | Link |
|---|---|---|---|
| Allium akaka subsp. bozgushense | PQ305991.1 | 153238 | View on NCBI ↗ |
| Allium aladaghense | PQ306013.1 | 152375 | View on NCBI ↗ |
| Allium alaicum | PQ306043.1 | 152217 | View on NCBI ↗ |
| Allium alamutense | PQ305992.1 | 153274 | View on NCBI ↗ |
| Allium alekii | PQ306003.1 | 153418 | View on NCBI ↗ |
| Allium alexeianum | PQ306027.1 | 152606 | View on NCBI ↗ |
| Allium altaicum | NC_040972.1 | 153129 | View on NCBI ↗ |
| Allium altissimum | PQ306039.1 | 151870 | View on NCBI ↗ |
| Allium amphibolum | NC_084231.1 | 153248 | View on NCBI ↗ |
| Allium angulosum | NC_077652.1 | 153473 | View on NCBI ↗ |
| Allium anisopodium | NC_068830.1 | 153407 | View on NCBI ↗ |
| Allium arkitense | PQ306044.1 | 152208 | View on NCBI ↗ |
| Allium aroides | PQ306037.1 | 152052 | View on NCBI ↗ |
| Allium assadii | PQ306017.1 | 152431 | View on NCBI ↗ |
| Allium atropurpureum | PQ306006.1 | 153220 | View on NCBI ↗ |
| Allium atrosanguineum | PZ015912.1 | 153521 | View on NCBI ↗ |
| Allium austrosibiricum | NC_077653.1 | 153493 | View on NCBI ↗ |
| Allium backhousianum | PQ306046.1 | 152256 | View on NCBI ↗ |
| Allium bakhtiaricum | PQ306041.1 | 152207 | View on NCBI ↗ |
| Allium bidentatum | NC_068829.1 | 153443 | View on NCBI ↗ |
| Allium bisotunense | PQ305998.1 | 153208 | View on NCBI ↗ |
| Allium brachyscapum | PQ306021.1 | 152598 | View on NCBI ↗ |
| Allium breviscapum | PQ305994.1 | 153173 | View on NCBI ↗ |
| Allium bucharicum | PQ306031.1 | 152644 | View on NCBI ↗ |
| Allium caeruleum | NC_049099.1 | 153267 | View on NCBI ↗ |
| Allium caesium | NC_068787.1 | 151533 | View on NCBI ↗ |
| Allium caespitosum | NC_068828.1 | 153667 | View on NCBI ↗ |
| Allium cardiostemon | PQ306004.1 | 153910 | View on NCBI ↗ |
| Allium caricoides | NC_062825.1 | 153075 | View on NCBI ↗ |
| Allium caspium subsp. baissunense | PQ306032.1 | 152522 | View on NCBI ↗ |
| Allium cepa | NC_024813.1 | 153538 | View on NCBI ↗ |
| Allium cepa var. aggregatum | OR605568.1 | 153736 | View on NCBI ↗ |
| Allium cernuum | NC_057572.1 | 153750 | View on NCBI ↗ |
| Allium changduense | NC_058218.1 | 153659 | View on NCBI ↗ |
| Allium chienchuanense | NC_065779.1 | 153549 | View on NCBI ↗ |
| Allium chitralicum | PQ306023.1 | 152555 | View on NCBI ↗ |
| Allium chlorotepalum | PQ305995.1 | 153103 | View on NCBI ↗ |
| Allium chrysantherum | PQ306008.1 | 153444 | View on NCBI ↗ |
| Allium chrysanthum | NC_042154.1 | 153621 | View on NCBI ↗ |
| Allium chrysocephalum | NC_042155.1 | 153710 | View on NCBI ↗ |
| Allium condensatum | NC_068831.1 | 154124 | View on NCBI ↗ |
| Allium confragosum | NC_068788.1 | 153119 | View on NCBI ↗ |
| Allium costatovaginatum | PQ306047.1 | 151831 | View on NCBI ↗ |
| Allium cretaceum | PZ015913.1 | 153076 | View on NCBI ↗ |
| Allium cristophii | PQ306014.1 | 152318 | View on NCBI ↗ |
| Allium cupuliferum subsp. cupuliferum | PQ306033.1 | 152360 | View on NCBI ↗ |
| Allium cyaneum | NC_058219.1 | 152230 | View on NCBI ↗ |
| Allium cyathophorum | NC_045912.1 | 154174 | View on NCBI ↗ |
| Allium cyathophorum var. farreri | NC_045843.1 | 153111 | View on NCBI ↗ |
| Allium cyrilli | PQ306007.1 | 153608 | View on NCBI ↗ |
| Allium darwasicum | PQ306024.1 | 152586 | View on NCBI ↗ |
| Allium decoratum | PQ306028.1 | 152577 | View on NCBI ↗ |
| Allium delicatulum | MN648631.1 | 152984 | View on NCBI ↗ |
| Allium deneliae | PQ306009.1 | 153423 | View on NCBI ↗ |
| Allium derderianum | PQ305996.1 | 153164 | View on NCBI ↗ |
| Allium dodecadontum | PQ306045.1 | 152257 | View on NCBI ↗ |
| Allium dumebuchum | NC_077654.1 | 153507 | View on NCBI ↗ |
| Allium eduardii | NC_068827.1 | 153497 | View on NCBI ↗ |
| Allium efeae | PQ306010.1 | 153525 | View on NCBI ↗ |
| Allium egorovae | PQ306001.1 | 153233 | View on NCBI ↗ |
| Allium elburzense | PQ306019.1 | 152557 | View on NCBI ↗ |
| Allium ellisii | PQ306016.1 | 152535 | View on NCBI ↗ |
| Allium esfahanicum | PQ306018.1 | 152432 | View on NCBI ↗ |
| Allium fasciculatum | NC_045845.1 | 152931 | View on NCBI ↗ |
| Allium ferganicum | NC_057975.1 | 153126 | View on NCBI ↗ |
| Allium fetisowii | NC_049100.1 | 154018 | View on NCBI ↗ |
| Allium filidens | NC_068789.1 | 153150 | View on NCBI ↗ |
| Allium fistulosum | NC_040222.1 | 153164 | View on NCBI ↗ |
| Allium flavescens | NC_077655.1 | 153428 | View on NCBI ↗ |
| Allium forrestii | NC_049101.1 | 153186 | View on NCBI ↗ |
| Allium funckiifolium | PV817864.1 | 153582 | View on NCBI ↗ |
| Allium fuscoviolaceum | NC_084232.1 | 153451 | View on NCBI ↗ |
| Allium galanthum | NC_050981.1 | 153222 | View on NCBI ↗ |
| Allium giganteum | PQ306042.1 | 152598 | View on NCBI ↗ |
| Allium glaciale | NC_084233.1 | 153409 | View on NCBI ↗ |
| Allium glomeratum | NC_068790.1 | 153406 | View on NCBI ↗ |
| Allium graveolens | PQ305993.1 | 153262 | View on NCBI ↗ |
| Allium guanxianense | NC_088574.1 | 152480 | View on NCBI ↗ |
| Allium gypsaceum | PQ306038.1 | 152314 | View on NCBI ↗ |
| Allium haemanthoides | PQ305999.1 | 153109 | View on NCBI ↗ |
| Allium hamedanense | PQ306000.1 | 153168 | View on NCBI ↗ |
| Allium haneltii | NC_068791.1 | 152344 | View on NCBI ↗ |
| Allium herderianum | NC_042156.1 | 153605 | View on NCBI ↗ |
| Allium hindukuschense | PQ306022.1 | 153032 | View on NCBI ↗ |
| Allium hissaricum | PQ306026.1 | 152295 | View on NCBI ↗ |
| Allium hookeri | NC_065781.1 | 153682 | View on NCBI ↗ |
| Allium hookeri var. hookeri | OK055713.1 | 153592 | View on NCBI ↗ |
| Allium hymenorrhizum | NC_084234.1 | 153289 | View on NCBI ↗ |
| Allium inconspicuum | PZ015914.1 | 152127 | View on NCBI ↗ |
| Allium inderiense | PZ015915.1 | 152029 | View on NCBI ↗ |
| Allium insufficiens | PQ306025.1 | 152507 | View on NCBI ↗ |
| Allium iranshahrii | PQ306002.1 | 153065 | View on NCBI ↗ |
| Allium isakulii | PQ306035.1 | 152572 | View on NCBI ↗ |
| Allium jesdianum subsp. angustitepalum | PQ306029.1 | 152625 | View on NCBI ↗ |
| Allium jesdianum subsp. jesdianum | PQ306030.1 | 152626 | View on NCBI ↗ |
| Allium jodanthum | NC_067034.1 | 152121 | View on NCBI ↗ |
| Allium karamanoglui | PQ306012.1 | 153269 | View on NCBI ↗ |
| Allium karataviense | NC_057573.1 | 151808 | View on NCBI ↗ |
| Allium kazerouni | PQ308285.1 | 152238 | View on NCBI ↗ |
| Allium keusgenii | PQ308307.1 | 153125 | View on NCBI ↗ |
| Allium kharputense | PQ308318.1 | 153368 | View on NCBI ↗ |
| Allium kingdonii | NC_046030.1 | 153559 | View on NCBI ↗ |
| Allium koelzii | PQ308317.1 | 153129 | View on NCBI ↗ |
| Allium koksuense | PQ308336.1 | 152911 | View on NCBI ↗ |
| Allium komarowii | PQ308293.1 | 152427 | View on NCBI ↗ |
| Allium koreanum | NC_057579.1 | 153162 | View on NCBI ↗ |
| Allium korolkowii | PZ015923.1 | 153271 | View on NCBI ↗ |
| Allium kujukense | PQ308337.1 | 149653 | View on NCBI ↗ |
| Allium ledebourianum | PV684023.1 | 152930 | View on NCBI ↗ |
| Allium lineare | PZ015916.1 | 153478 | View on NCBI ↗ |
| Allium lipskyanum | PQ308292.1 | 152459 | View on NCBI ↗ |
| Allium lusitanicum | OR884983.1 | 153482 | View on NCBI ↗ |
| Allium lycaonicum | PQ308321.1 | 153685 | View on NCBI ↗ |
| Allium macleanii | PQ308305.1 | 152350 | View on NCBI ↗ |
| Allium macranthum | NC_049102.1 | 152876 | View on NCBI ↗ |
| Allium macrostemon | NC_077656.1 | 153126 | View on NCBI ↗ |
| Allium mahneshanense | PQ308316.1 | 153100 | View on NCBI ↗ |
| Allium mairei | NC_045913.1 | 152913 | View on NCBI ↗ |
| Allium majus | PQ308298.1 | 152624 | View on NCBI ↗ |
| Allium maowenense | NC_042157.1 | 153608 | View on NCBI ↗ |
| Allium materculae | PQ308313.1 | 153178 | View on NCBI ↗ |
| Allium michaelis | NC_068792.1 | 153134 | View on NCBI ↗ |
| Allium microdictyon | NC_077657.1 | 153561 | View on NCBI ↗ |
| Allium minus | NC_077658.1 | 153499 | View on NCBI ↗ |
| Allium minutiflorum | PQ308310.1 | 153083 | View on NCBI ↗ |
| Allium mirum | PQ308306.1 | 152670 | View on NCBI ↗ |
| Allium moderense | PQ308312.1 | 153095 | View on NCBI ↗ |
| Allium moly | MZ019477.1 | 153793 | View on NCBI ↗ |
| Allium monanthum | NC_042726.1 | 154804 | View on NCBI ↗ |
| Allium mongolicum | NC_062084.1 | 153609 | View on NCBI ↗ |
| Allium monophyllum | PQ308324.1 | 152838 | View on NCBI ↗ |
| Allium montanostepposum | PZ015917.1 | 152938 | View on NCBI ↗ |
| Allium mozaffarianii | PQ308322.1 | 153494 | View on NCBI ↗ |
| Allium muliense | ON184008.1 | 153113 | View on NCBI ↗ |
| Allium nanodes | NC_045520.1 | 154032 | View on NCBI ↗ |
| Allium neriniflorum | NC_049103.1 | 154280 | View on NCBI ↗ |
| Allium nerinifolium | NC_057574.1 | 154129 | View on NCBI ↗ |
| Allium nevskianum | PQ308301.1 | 152560 | View on NCBI ↗ |
| Allium nigrum | NC_057585.1 | 152241 | View on NCBI ↗ |
| Allium nikolaii | NC_068793.1 | 152485 | View on NCBI ↗ |
| Allium nuratavicum | PQ306034.1 | 152319 | View on NCBI ↗ |
| Allium nutans | PZ015918.1 | 153513 | View on NCBI ↗ |
| Allium obliquum | NC_037199.1 | 152387 | View on NCBI ↗ |
| Allium ochotense | NC_057581.1 | 154048 | View on NCBI ↗ |
| Allium oleraceum subsp. oleraceum | OR884984.1 | 152189 | View on NCBI ↗ |
| Allium omeiense | NC_065780.1 | 153592 | View on NCBI ↗ |
| Allium ophiophyllum | PZ269957.1 | 152642 | View on NCBI ↗ |
| Allium oreophilum | PQ308338.1 | 152357 | View on NCBI ↗ |
| Allium orientale | PQ306011.1 | 153323 | View on NCBI ↗ |
| Allium oschaninii | NC_044470.1 | 153580 | View on NCBI ↗ |
| Allium ovalifolium | NC_062881.1 | 153706 | View on NCBI ↗ |
| Allium ovalifolium var. cordifolium | PV817884.1 | 153705 | View on NCBI ↗ |
| Allium ovalifolium var. leuconeurum | PV817892.1 | 153699 | View on NCBI ↗ |
| Allium pallasii | NC_068794.1 | 151465 | View on NCBI ↗ |
| Allium pangasicum | PQ308328.1 | 151737 | View on NCBI ↗ |
| Allium plurifoliatum | NC_058220.1 | 153234 | View on NCBI ↗ |
| Allium polyrhizum | NC_049104.1 | 153086 | View on NCBI ↗ |
| Allium praemixtum | NC_044412.1 | 153226 | View on NCBI ↗ |
| Allium prattii | NC_037432.1 | 154482 | View on NCBI ↗ |
| Allium prostratum | NC_077659.1 | 153597 | View on NCBI ↗ |
| Allium protensum | PQ308299.1 | 152575 | View on NCBI ↗ |
| Allium pseudohollandicum | PQ308288.1 | 152610 | View on NCBI ↗ |
| Allium pseudowinklerianum | PQ308333.1 | 151535 | View on NCBI ↗ |
| Allium pskemense | NC_044411.1 | 153788 | View on NCBI ↗ |
| Allium ramosum | NC_084235.1 | 153494 | View on NCBI ↗ |
| Allium regelii | PQ308325.1 | 152587 | View on NCBI ↗ |
| Allium remediorum | PQ308289.1 | 152285 | View on NCBI ↗ |
| Allium rosenorum | PQ308300.1 | 152857 | View on NCBI ↗ |
| Allium roylei | NC_084236.1 | 153588 | View on NCBI ↗ |
| Allium rude | NC_042158.1 | 153697 | View on NCBI ↗ |
| Allium sabulosum | NC_068795.1 | 151627 | View on NCBI ↗ |
| Allium sahandicum | PQ308315.1 | 153236 | View on NCBI ↗ |
| Allium saralicum | PQ308319.1 | 153239 | View on NCBI ↗ |
| Allium sarawschanicum | PQ308302.1 | 152879 | View on NCBI ↗ |
| Allium sativum | NC_031829.1 | 153172 | View on NCBI ↗ |
| Allium schachimardanicum | PQ308304.1 | 153094 | View on NCBI ↗ |
| Allium schisticola | PQ308320.1 | 153046 | View on NCBI ↗ |
| Allium schoenoprasoides | NC_049105.1 | 153583 | View on NCBI ↗ |
| Allium schoenoprasum | NC_057575.1 | 152852 | View on NCBI ↗ |
| Allium scotostemon | PQ308327.1 | 152285 | View on NCBI ↗ |
| Allium senescens | NC_057580.1 | 153542 | View on NCBI ↗ |
| Allium severtzovioides | PQ308329.1 | 151791 | View on NCBI ↗ |
| Allium sewerzowii | PQ308330.1 | 151790 | View on NCBI ↗ |
| Allium siculum | NC_057584.1 | 154225 | View on NCBI ↗ |
| Allium sikkimense | NC_058221.1 | 152549 | View on NCBI ↗ |
| Allium songpanicum | MN648634.1 | 153247 | View on NCBI ↗ |
| Allium spicatum | NC_045911.1 | 153187 | View on NCBI ↗ |
| Allium spirale | NC_068826.1 | 153549 | View on NCBI ↗ |
| Allium splendens | NC_084237.1 | 153416 | View on NCBI ↗ |
| Allium spurium | NC_077660.1 | 153529 | View on NCBI ↗ |
| Allium stipitatum | PQ308290.1 | 152191 | View on NCBI ↗ |
| Allium strictum | NC_049106.1 | 152962 | View on NCBI ↗ |
| Allium subakaka | PQ308314.1 | 153158 | View on NCBI ↗ |
| Allium suworowii | PQ308326.1 | 152572 | View on NCBI ↗ |
| Allium taeniopetalum | PQ308295.1 | 151931 | View on NCBI ↗ |
| Allium tanguticum | NC_068796.1 | 152980 | View on NCBI ↗ |
| Allium tenuissimum | NC_068825.1 | 153459 | View on NCBI ↗ |
| Allium teretifolium | NC_080287.1 | 153353 | View on NCBI ↗ |
| Allium tetraploideum | NC_061763.1 | 152906 | View on NCBI ↗ |
| Allium thunbergii var. deltoides | OQ701006.1 | 152457 | View on NCBI ↗ |
| Allium thunbergii var. teretifolium | OQ701013.1 | 153353 | View on NCBI ↗ |
| Allium tianschanicum | PZ015921.1 | 153315 | View on NCBI ↗ |
| Allium trautvetterianum | PQ308303.1 | 152322 | View on NCBI ↗ |
| Allium tricoccum | NC_057583.1 | 153565 | View on NCBI ↗ |
| Allium trifurcatum | NC_045844.1 | 153456 | View on NCBI ↗ |
| Allium tripedale | PV409669.1 | 154225 | View on NCBI ↗ |
| Allium triquetrum | NC_064123.1 | 153249 | View on NCBI ↗ |
| Allium tschimganicum | PQ308331.1 | 151823 | View on NCBI ↗ |
| Allium tuberosum | NC_044709.1 | 154056 | View on NCBI ↗ |
| Allium turkestanicum | PZ015922.1 | 152759 | View on NCBI ↗ |
| Allium ubipetrense | PQ308308.1 | 153174 | View on NCBI ↗ |
| Allium ulleungense | NC_077661.1 | 154049 | View on NCBI ↗ |
| Allium ursinum | MH157875.2 | 153252 | View on NCBI ↗ |
| Allium vavilovii | NC_084238.1 | 153573 | View on NCBI ↗ |
| Allium victorialis | NC_037240.1 | 154074 | View on NCBI ↗ |
| Allium victoris | PQ308332.1 | 151808 | View on NCBI ↗ |
| Allium viridiflorum | PQ308296.1 | 152148 | View on NCBI ↗ |
| Allium wallichii | NC_065777.1 | 152615 | View on NCBI ↗ |
| Allium wallichii var. platyphyllum | ON184004.1 | 152926 | View on NCBI ↗ |
| Allium winklerianum | PQ308297.1 | 152295 | View on NCBI ↗ |
| Allium x cepiforme | NC_062794.1 | 153152 | View on NCBI ↗ |
| Allium xiangchengense | NC_065778.1 | 152294 | View on NCBI ↗ |
| Allium xichuanense | NC_042159.1 | 153673 | View on NCBI ↗ |
| Allium yingshanense | PP056265.1 | 152183 | View on NCBI ↗ |
| Allium zagricum | PQ308309.1 | 153167 | View on NCBI ↗ |
| Allium zebdanense | MZ019480.1 | 153147 | View on NCBI ↗ |
| Allium zergericum | PQ308335.1 | 152276 | View on NCBI ↗ |